ISSN: 2329-8731
+44 1300 500008
Research Article - (2022)Volume 10, Issue 4
Antibiotics had been a pivotal substance to be supplemented in the food for poultry flock with a main purpose to improve their yields in order to gain profits. However, its long-term use costs some adverse effects such as resistance and tolerance. Hence, a new platform is of urgency to figure out. We discovered that our probiotic bacteria, which through the whole-genome sequencing was identified as Limosilactobacillus reuteri strain Byun-re-01 (L. reuteri Byun- re-01), exhibited promising biological properties to substitute the existing use of antibiotics. Oral administration of L. reuteri Byun-re-01 was shown to provide local protection by producing anti-inflammatory cytokines mainly IFN-β and IFN-γ in mRNA levels. In addition, they suppressed the expression of viral capsid mRNA of MNV indicating their antiviral activity. They were not detected to translocate to distant organs but to reside and colonize only within the gut. The ALT/AST levels in the serums of mice receiving L. reuteri Byun-re-01-treatment were observed to be at normal range suggesting that no functional damages of the mice’s livers were detected. Overall, our results showed favorable profiles of antiviral-carrying probiotics in L. reuteri Byun-re-01 that render it a promising candidate of non- antibiotic preservatives.
Limosilactobacillus reuteri strain Byun-re-01; Probiotic; Safety; Immunomodulatory effect; Anti-murine norovirus; Probiotic-specific markers
Rapid development in the poultry industry has produced high yields in breeding facilities. However, it causes higher immunological stress reactions and worsen the risk of disease outbreaks in commercial poultry flocks [1]. Severe stresses are the primary epidemiological factor that induces immune stress response that further reduces their productivity [2]. This is unacceptable because productivity or yield is the core of purposes. Thus, antibiotics were thought to be the answer for how to maintain the productivity of the commercial poultry [3]. Its use as a supplementary component in the feed was evidenced to improve up to 10% of the daily growth of animals. Furthermore, the meat produced from the antibiotic- fed animals was observed to be richer in protein but lesser in fat compared to that fed with no antibiotic [4]. However, continuous use of antibiotic has arisen a major concern, that is the antibiotic- resistance and tolerance which would hamper pathogen eradication during infection. These two, thus far, are a persistent health care problem globally, hence other platforms than antibiotics are urged to be discovered [3].
An interesting report by Jose, et al. showed that rumen-origin probiotic bacteria exhibited three excellent features: 1) high tolerance to stress conditions, 2) high inhibition of pathogen growth, and 3) high adherence property [2]. The rumen-origin bacteria co-exist with pathogens in the intestine thus competitive relationship between the two populations is maintained rendering the rumen-origin bacteria display a considerably high inhibition to the pathogen growth than that shown by dairy-origin isolates [2]. This inspired us to dig deeper in the probiotic bacteria-realm in order to discover novel rumen-origin bacteria which were potentially advantageous to address huge troublesome faced in the poultry productivity, particularly in improving the overall growth and quality of the products, which was expected to outperform antibiotics use.
Some bacteria species such as Limosilactobacillus reuteri (L. reuteri), Lactobacillus johnsonii (L. johnsonii), Lactobacillus gasseri (L. gasseri), Limosilactobacillus fermentum (L. fermentum), and Lactobacillus plantarum (L. plantarum) are well known for their probiotics properties [5]. They are reported to be capable of inhibiting rotavirus infection by magnifying the expression of interferon-α (IFN-α), IFN-β, and IFN-induced antiviral effectors such as myxovirus resistance-A, 20,50-oligoadenylate synthetase, and protein kinase R [6]. The bacteria are commonly harnessed as a medicament to treat patients with diarrhea and inflammatory bowel disease [7]. However, in immunocompromised patients, instead of eliciting protection mechanisms which favor the patients’ health, the bacteria induce rare infections such as bacteremia, particularly caused by Lactobacillus, and endocarditis that is ascribed to Bifidobacterium [8,9]. Therefore, it is critical to secure the safety before utilization, especially if the bacteria inhabit within the digestion system of human or animal [10]. Up to date, norovirus-induced digestion system diseases are not licensed to any specific treatment which speaks more volume in the urgency to pick it as our focus in this particular study [11]. Unfortunately, as in vitro setting of human norovirus is yet to be available however, a standardized in vitro instrument to investigate human norovirus was and is yet to be available thus a surrogate system which mimics this at best is necessitated [12]. In this purpose that murine norovirus (MNV) emerges as an excellent substitute [13-15].
There have been a few reports showed that Bifidobacterium, Lactobacillus, and Lactococcus, were capable of conferring resistance against MNV [15]. A couple years later we displayed similar features where our L. paracasei ATCC 334, which was prior-engineered to express 3D8 single-chain variable fragment (scFv), elicited antiviral activities against MNV. In addition, a report from Cho et al. demonstrated that the probiotic activity of the L. paracasei ATCC 334 was the primary cause for the bulking-up population of Pediococcus acidilactici and the lowered population of Helicobacter in the mice intestines [16]. This specific result has driven us to an initial yet critical understanding that the L. paracasei ATCC 334 was a promising probiotic candidate. However, the survival rate of the L. paracasei ATCC 334 might be a major drawback for its utilization because the bacteria were observed to be having a low survival rate where practically they were expected to highly survive.
Furthermore, as their colonies were considerably short-lived, this adds more to the hindering aspect of exploiting L. paracasei ATCC 334 as an antiviral-eliciting probiotic. This led us to a novel finding of murine intestine-isolated probiotic bacteria which was further identified and classified as Limosilactobacillus reuteri strain Byunre- 01 (L. reuteri Byun-re-01). At last, we performed whole-genome and transcriptome sequencing to evaluate biosafety markers of the L. reuteri Byun-re-01. Altogether, our results can serve as a strong basis for the use of probiotic-potential bacteria as preservatives which might promote or improve immune responses of the host against viral-attacks.
Bacterial isolation and culture conditions
Six-week-old, specific pathogen-free ICR mice (DBL, Eumseong, Korea) were sacrificed before isolating Lactobacillus from their small intestines. The small intestines were cut into three parts: duodenum, jejunum, and ileum. The extracted tissues were homogenized with 1.6 mm stainless steel beads (Next Advance, NW, USA) and phosphate-buffered saline (PBS). The homogenized tissues were spread on Man-Rogosa-Sharpe (MRS) plates (Merck Millipore, Boston, MA, USA), to grow various Lactobacillus species. We randomly selected a colony among the colonies grown on the MRS plate. Only bacteria that were rod-shaped under microscopy were selected and cultured anaerobically in MRS broth for two days at 37°C. The isolated bacteria were maintained in MRS medium supplemented with 80% glycerol. As a positive control, the probiotic strains Lacticaseibacillus paracasei ATCC 334 and Limosilactobacillus reuteri KACC 11452, which were provided by the courtesy of Dr. Jos Seegers (Falcobio, Leiden, Netherlands) and the Rural Development Administration (Jeonju, Korea), respectively.
Primer design
All primers used in this study are listed in Table 1 [17]. The 9F and 1542R primers were used to determine bacterial species using 16S ribosomal DNA (rDNA) as previously reported [18]. DNA gyrase subunit B (gyrB) was used to retrieve the sequences of several Lactobacillus species from GenBank (www.ncbi.nlm.nih.gov) to perform multiple alignments via MultAlin. The DNA gyrB primer was designed for the region of the gyrB sequence most conserved among several Lactobacillus species. The sets of cytokine primers and MNV detection primers were designed using the Primer 3 program.
Gene | Forward (5’→3’) | Reverse (5’→3’) | Reference |
---|---|---|---|
16S rDNA | GAGTTTGATCCTGGCTCAG | AGAAAGGAGGTGATCCAGCC | [17] |
DNA gyrase subunit B | GCGGAAGCGGCCNGSNATGTA | CCGTCCAGCTCGGCRTCNGYCAT | This study |
GAPDH | TGGCAAAGTGGAGATTGTTGCC | AAGATGGTGATGGGCTTCCCG | NM_002046 |
IFN-β | TTACACTGCCTTTGCCATCCAA | TCCCACGTCAATCTTTCCTCTT | NM_010510.1 |
IFN-γ | ACTGGCAAAAGGATCGTGAC | GACCTGTGGGTTGTTGACCT | NM_008337.3 |
MNV capsid protein | CTCTCAGCCATGTACACCGG | TAGGGTGGTACAAGGGCAACAA | JQ237823.1 |
Table 1: All primers used in this study.
Identification of limosilactobacillus
Two conserved genes, 16S rDNA and DNA gyrB, were used to identify bacterial species. Purification of each PCR product was conducted using a Zymoclean™ Gel DNA Recovery Kit (Zymo Research, CA, USA), followed by Sanger/capillary sequencing (Macrogen, Seoul, Korea). Bacterial species were identified using the EzTaxon-e database with 16S rDNA data and BLAST analysis of the gyrB data [18].
Phylogenetic analysis
Gene sequences of 16S rDNA and gyrB were retrieved from GenBank (www.ncbi.nlm.nih.gov). Multiple alignments were next performed by using MEGA program (version 7). Parallelly, to construct phylogenetic trees between L. reuteri Byun-re-01 and other L. reuteri strains namely L. rhamnosus GG, L. fermentum IFO 3956 and L. paracasei ATCC 334, we applied neighbor-joining method with bootstrap values (1,000 replicates) in MEGA program.
Whole-genome sequencing, assembly, and annotation
Whole-genome sequencing of L. reuteri Byun-re-01 was performed following published methods [19]. Bacterial genomic DNA was extracted using a G-spin™ Genomic DNA Extraction Kit (iNtRON, Sungnam, Korea) following to the manufacturer’s protocols. The sequencing was performed via two sequencing platforms: PacBio RS II (Pacific Biosciences, CA, USA) and Illumina Hiseq 2000 (Illumina, Inc., CA, USA), at Macrogen (Seoul, Korea). The construction of the complete genome of L. reuteri Byun-re-01 was done in a two-step assembly process. First, de novo assembly of the PacBio raw sequencing data was conducted using Single Molecule, Real-Time (SMRT) Analysis software version 2.3.0 [20]. Second, hybrid assembly of the Illumina raw sequencing data was performed using Pilon (v1.21) to increase the accuracy of the assembly. The complete genome was annotated using Prokka software version 1.12b. The resulting complete genome of L. reuteri Byun-re-01 was registered at the Pubmed’s GenBank with an accession number CP029613.
Comparative genomic analysis
By using the data from the NCBI genome database (http://www. ncbi.nlm.nih.gov/genome), nine L. reuteri strains were selected based on the phylogeny results (L. reuteri strains DSM 20016, IRT, JCM 1112, I49, TD1, ATCC 53608, ZLR003, I5007, and SD2112) and compared with the whole genome of L. reuteri Byun-re-01. The OrthoANI algorithm was used to compare the similarity of the ten genomes to determine whether the isolated strain was a novel type [21]. A phylogenetic tree was constructed based on the OrthoANI values of the L. reuteri strains.
Mice, virus, and cells
Six-week-old female ICR mice (DBL, Eumseong, Korea) were used as our resource to isolate the Lactobacillus strains from. On the other hand, 6 weeks of female C57BL/6 mice were employed to assay antiviral activity of Limosilactobacillus isolates against MNV strain CR6 (MNV CR6). All mice were acclimatized for one week prior to the main experiment. The mice were housed following a standardized laboratory condition. RAW264.7 cells were cultured in Dulbecco’s modified Eagle’s medium (Hyclone, Logan, UT, USA) containing 10% heat-inactivated fetal bovine serum (FBS) (Alphabioregen, Boston, USA), 100 units/ml of penicillin, 100 μg/ml streptomycin (Pan Biotech, Aidenbach, Germany), 10 mM HEPES, and 2 mM glutamine in a 5% CO2 incubator at 37°C. MNV CR6 was provided by the courtesy of Dr. Herbert W. Virgin from Washington University and proliferated in RAW264.7 cells [22].
Selection tool for evaluating survival rate of Limosilactobacillus
A pSLP111.3 vector was provided by Dr. Jos Seegers (Falcobio, Leiden, Netherlands). It was prior-modified by replacing the xylose-inducible promoter with a lactate dehydrogenase constitutive promoter and transformed into Limosilactobacillus and Lacticaseibacillus was performed as previously described [15]. These transformed bacteria were, then, used to measure the retention time of Limosilactobacillus and Lacticaseibacillus in the Gastrointestinal Tract (GIT) of mice as previously described [23].
Preparation of Limosilactobacillus strain for administration
Bacterial seeds were inoculated with MRS medium at a 1:50 ratio and incubated for 16 hours at 37°C. After diluting the culture to the OD600: 1, the culture was subjected to 10-fold serial dilutions and spread on the MRS plate. The number of colonies forming units (CFUs) of Limosilactobacillus and Lacticaseibacillus strains contained in 1 ml of medium was calculated by the plate counting method. Based on that CFU value, 108 CFUs were harvested and prepared.
Persistence of Limosilactobacillus strain in the GIT of mice
To determine the retention time of the L. reuteri Byun-re-01 in murine intestines, mice were assigned to several experimental groups as follows: 1) the presence or absence of antibiotic pretreatment before the experiment and 2) the number of feedings. Three ICR mice were assigned to each of the four experimental groups. To allow for retention of the pSLP111.3 vector and remove partially commensal bacteria in the intestine, all mice were given water containing 3 μg/ml chloramphenicol for 24 h. Food and water were removed for 18 h before the probiotic feeding. The mice were fed 108 CFUs of L. paracasei ATCC 334 and L. reuteri Byunre- 01 for several assignments: only once or once every two days, over six days. In the experimental group that did not receive antibiotics, the mice were fed 108 CFUs of bacteria. After feeding, food and water containing antibiotics were given to the mice again. Feeding needles (20 gauge) were used for all oral administration procedures. Feces (1 g) were collected daily from each cage and resuspended in PBS, followed by serial dilution. Diluted fecal samples were plated on MRS plates supplemented with 3 μg/ml of chloramphenicol and incubated anaerobically at 37°C for two days. In the negative control group, mice were fed PBS to match the other experimental conditions. CFUs were calculated using a plate counting method.
Assessment of bacterial translocation
The translocation of bacteria from the gut to the blood and other tissues was assessed as previously described [24]. The liver and kidneys were harvested aseptically, and each organ was homogenized. About 100 μl of homogenates and 20 μl of blood were plated on MRS agar and Brain Heart Infusion agar (BHI) (BD Biosciences, San Jose, CA, USA). Next, the plates were incubated for 48 hours at 37°C.
Gut-associated immunomodulation by Limosilactobacillus strain
Total RNA from intestine tissues was extracted using TRI reagent (Molecular Research Center, Inc., Cincinnati, OH, USA). cDNA was synthesized from 2 μg of total RNA with oligo dT primer and Moloney murine leukemia virus reverse transcriptase (Bioneer, Daejeon, Korea) following the manufacturer’s protocols. To quantify Limosilactobacillus- and Lacticaseibacillus strains-induced cytokine levels, Rotor-Gene Q system-based quantitative real-time PCR (Qiagen, Chadstone, Victoria, Australia) was performed. SYBR Premix Ex Taq (TaKaRa, Kyoto, Japan) was used for PCR amplification and intercalator. Data were analyzed using Rotor- Gene Q series software version 2.3.1 (Qiagen).
Quantification of MNV titer
A plaque-based assay was performed as previously described to determine the virus concentration [25]. We used 0.5% crystal violet (Sigma-Aldrich, St. Louis, USA) for plaque visualization after fixation with 4% formaldehyde (Sigma-Aldrich). A negative control well was added per plaque assay.
Antiviral activity test Against MNV CR6
Six-week-old, MNV-seronegative female C57BL/6 mice were used to evaluate the anti-MNV activity of L. reuteri Byun-re-01. Its antiviral activity was compared with that of the L. paracasei ATCC 334 strain and the L. reuteri KACC 11452 strains derived from humans. Mice were fed 108 CFUs of wild-type L. reuteri Byun-re-01, L. reuteri KACC 11452, or L. paracasei ATCC 334 for two weeks, followed by infection with 105 plaque-forming units (PFUs) of MNV. Stool sampling was performed on days 5, 7, 9, and 14 after viral infection. Fecal RNA was extracted using a Quick-RNATM Fecal/Soil Microbe Microprep kit (Zymo Research, CA, USA). cDNA was synthesized using CellScript cDNA synthesis master mix (CellSafe, Yongin, Korea), and viral titers were compared among experimental groups using quantitative real-time PCR in the same manner as described above.
RNA extraction and transcriptome sequencing
After being cultured at pH 4.8, L. reuteri Byun-re-01 were lysed using lysozyme (20 mg/ml) and mutanolysin (50 U/ml) (Sigma Aldrich, St. Louis, MO, USA) treatment and subjected to the total RNA extraction using NucleoSpin® RNA kit (MACHEREYNAGEL, Düren Germany). Following treatment with DNase to prevent DNA contamination of the total RNA samples, mRNA purification was performed using Ribo-Zero rRNA Removal Kit (Bacteria) (Illumina, Inc., CA, USA). A TruSeq RNA Sample Prep Kit v2 was then used according to the manufacturer’s instructions for library preparation. Paired-end libraries with 200bp–400bp insert sizes were sequenced using a HiSeq2000 (Macrogen, Seoul, Korea).
Calculation mapping and fragments per kilobase of transcript per million mapped reads
The raw data (4 fastq files) generated from the Illumina sequencing were deposited in GenBank under accession number SRR8988597. Trimmed reads were resulted fromTrimmomatic 0.32 software to remove the adaptor sequence. Those reads were mapped on the reference sequence (the genome of L. reuteri Byun-re-01) using BBMap (short-read aligner) with default parameters. After the mapping process, data mining to find probiotic-specific markers was performed [26].
Statistical analysis
Our data point was arranged as triplicates and presented as means ± SEM in GraphPad Prism (GraphPad software version 5). One way ANOVA was performed, and significance was determined by the P value<0.05.
Isolation and identification of Limosilactobacillus strains from mouse small intestines
We screened more than 200 colonies from duodenal tissues and selected 80 rod-shaped bacteria for further strain identification using 16S rDNA sequences. Most isolates were identified as L. reuteri strains, with an exception to a few species such as Lactobacillus intestinalis and putative Lacticaseibacillus paracasei. This analysis also resulted in 99.47% similarity to that seen in L. reuteri JCM 1112. In addition, we also performed characterization using gyrB which resulted in 99.64% similarity to that of L. reuteri strain I49. Given these results from both 16S rDNA and gyrB analysis, we only took L. reuteri isolates for further analysis.
Phylogenetic analysis bsed on conserved genes of L. reuteri strains
The aligned sequences, which had an average of 1,500 bp and 1,900 bp of 16S rDNA and gyrB sequences, respectively, were analyzed to determine the phylogenetic relationships. Phylogenetic trees were constructed based on the neighbor-joining method using bootstrap values (1,000 replicates) (Figure 1). They showed that the L. reuteri mouse isolates were genetically in proximity to various L. reuteri strains.
Figure 1: Phylogenetic tree based on comparison of 16S rDNA and gyrB sequences of L. reuteri mouse isolates and reference sequences. The phylogenetic trees were generated using the neighbor-joining method with an average of 1,500 aligned nucleotides in 16S rDNA (A) and gyrB (B). Bootstrap values (from 1,000 replicates) are shown at the branch points. Most values were greater than 40%. The Limosilactobacillus, Levilactobacillus, Lactiplantibacillus, Ligilactobacillus, Lacticaseibacillus, and Lactobacillus species used to determine genetic relationships included: various L. reuteri strains, L. fermentum, L. crispatus, L. brevis, L. paracasei, L. salivarius, L. plantarum, L. rhamnosus, L. iners, L. johnsonii, L. jensenii, L. acidophilus, L. delbrueckii, and L. helveticus. The scale represents 0.1 nucleotide substitution per position.
Analysis of the genomic features of the isolated Limosilactobacillus strain
As delineated in the bacteria screening results, most of the isolated bacteria were identified as L. reuteri. As we needed to evaluate that the bacteria were probiotic-potential, we performed whole genome sequencing analysis using general genomic features detailed in Table 2. This generated a strain map of L. reuteri Byun-re-01 (Figure 2). A total of 68,530,004 paired end reads generated from the Illumina sequencing and 128,652 long reads generated from the PacBio sequencing were employed to construct the complete chromosome. The complete genome of L. reuteri Byun-re-01 was 2,244,514 bp long (N50 values 2,244,514 bp) with 38.9% GC content constituted the genome. This genome contained 18 rRNA genes, 72 tRNA genes, and 2,083 protein-coding sequences. Furthermore, we identified the distribution of clusters of orthologous groups (COGs) from the genome.
L. reuteri Byun-re-01 | |
---|---|
Sequencing platforms | PacBio RS II / Illumina Hiseq2000 |
Assembler | PacBio SMRT Analysis 2.3.0 / Pilon (v1.21) |
Number of reads | 128,652 (PacBio) / 68,530,004 (Illumina) |
Genome coverage | 404 |
Genome size (bp) | 22,44,514 |
G+C content (%) | 38.9 |
Predicted CDS | 2,083 |
Number of contigs | 1 |
Number of rRNA genes | 18 |
Number of tRNA genes | 72 |
N50 (bp) | 22,44,514 |
Table 2: General genome features of L. reuteri Byun-re-01.
Figure 2: Circular representation of the L. reuteri Byun-re-01 genome. Circular map of the Limosilactobacillus reuteri strain Byun-re-01 genome. Marked characteristics are shown from outside to the center; CDS on forward strand, CDS on reverse strand, tRNA (light green), rRNA (red), GC content, and GC skew. This map was generated by circos.
In order to check if our newly discovered bacterial strain was novel, we compared our whole-genome results with top nine closest reference strains (Figure 3). A phylogenetic tree was constructed based on the average nucleotide identity (ANI) values. L. reuteri Byun-re-01 had more than 95% similarity to the other L. reuteri strains that were previously accessioned in NCBI database (Figure 4). It solidified the novelty of L. reuteri Byun-re-01. This particular strain was then registered to NCBI genome database with accession number CP029613.
Figure 3: Analysis of clusters of orthologous groups (COG) functional categories. Abundance of COG functional categories in L. reuteri Byunre-01. Coding sequences were identified using PSI-BLAST through
NCBI COGs, 2014 version (http://www.ncbi.nlm.nih.gov/COG/), based on sequence homology.
Figure 4: Comparison of whole-genome sequence among Limosilactobacillus strains through comparative genome analysis. An ANI phylogenetic tree was constructed based on OrthoANI values. Similarities between two genomes are indicated next to the phylogenetic tree.
Persistence of Limosilactobacillus strain in the gastrointestinal tract
Probiotics should possess resistance to low pH to survive and colonize in the gastrointestinal tract (GIT). The chloramphenicol resistance gene and lactate dehydrogenate constitutive promoter, which was inserted into the pSLP111.3 expression vector Figure 5, were harnessed to positively select intestinal low pH-resistant strains of L. reuteri Byun-re-01, to represent Limosilactobacillus, and L. paracasei ATCC 334, to represent Lacticaseibacillus [15]. Our data show that the survival rate of L. reuteri Byun-re-01 was higher than that of L. paracasei in all doses we gave (Figures 6A and 6B). Furthermore, in the absence of antibiotic, L. reuteri Byun-re-01 remained in the GIT longer than L. paracasei. However, all strains survived shorter compared to that seen in antibiotics-treated mice counterpart (Figures 6C and 6D).
Figure 5: Schematic representation of the vector used to determine the retention time of L. reuteri Byun-re-01 in the small intestine.
Figure 6: Intestinal colonization of Limosilactobacillus reuteri Byun-re-01 as a probiotic under various conditions. (A) Administration of 108 CFUs of L. paracasei ATCC 334 and L. reuteri Byun-re-01 once with antibiotic pretreatment. (B) Administration of 108 CFUs of L. paracasei ATCC 334 and L. reuteri Byun-re-01 three times (every two days) with antibiotic pretreatment. (C) Administration of 108 CFUs of L. paracasei ATCC 334 and L.reuteri Byun-re-01 once without antibiotic pretreatment. (D) Administration of 108 CFUs of L. paracasei ATCC 334 and L. reuteri Byun-re-01 three
times (every two days) without antibiotic pretreatment. Data are presented as the means ± SEM. Note: Negative control,
L. paracasei ATCC 334,
L. reuteri Byun-re-01.
Safety assessment of L. reuteri byun-re-01 strain
To assess whether or not the isolated L. reuteri Byun-re-01 safe for consumption, this strain was orally administered to mice for two weeks. As comparison, we had L. paracasei ATCC 334, to represent Lacticaseibacillus strains and control. We did not observe significant change in the daily food intake in L. paracasei ATCC 334-treated, L. reuteri Byun-re-01-treated groups, even in the control group. However, in terms of increment volume of food intake, L. reuteri Byun-re-01 group was in closer range to that seen in control group (Figure 7 and Table 3). In addition, significant disparities, including weight, size and histological outlooks, neither was observed macroscopically in livers, intestines and spleens (Table 4). These suggest that L. reuteri Byun-re-01 did not carry adversepotential impact.
Figure 7: Comparison of weight changes in mice treated with Limosilactobacillus and Lacticaseibacillus strains. The L. paracasei strain ATCC 334 (as a positive control) and L. reuteri Byun-re-01 were fed to mice daily for two weeks. The body weights of the mice treated with the Limosilactobacillus and Lacticaseibacillus strains were measured during the administration period. Data are presented as the means ± SEM for n=3. Note: Negative control,
L. paracasei ATCC 334,
L. reuteri Byun-re-01.
Strain | Food intake (g) |
---|---|
Negative control | 7.88 ± 0.65 |
L. paracasei ATCC 334 | 7.27 ± 1.04 |
L. reuteri Byun-re-01 | 7.66 ± 0.74 |
Note: Food intake of mice fed bacteria was measured once every two days. Data are presented as the means ± SEM for n=3. |
Table 3: Measurement of food intake during administration of Limosilactobacillus and Lacticaseibacillus strains.
Group | Liver (g) | Intestine (g) | Spleen (g) |
---|---|---|---|
Negative control | 1.27 ± 0.01 | 0.67 ± 0.02 | 0.1 ± 0.01 |
L. paracasei ATCC 334 | 1.24 ± 0.04 | 0.65 ± 0.05 | 0.11 ± 0.02 |
L. reuteri Byun-re-01 | 1.28 ± 0.21 | 0.62 ± 0.02 | 0.08 ± 0.03 |
Note: After the administration period, mice were sacrificed, and their livers, small intestines, and spleens were harvested. There were no significant differences in all groups. An approximately 10 cm section of small intestine was excised and weighed. Data are presented as the means ± SEM for n=3.
Table 4: Organ weight measurements of mice fed Limosilactobacillus and Lacticaseibacillus strains.
Bacterial translocation assessment
Bacterial translocation is defined as an event in which the administered bacteria migrated from the intestinal tissue into the blood or other organs. We did not observe bacteria translocation from the gut to other tissue in negative control and L. reuteri Byunre- 01 treated groups (Table 5). In the case of the mice receiving L. paracasei ATCC 334 treatment, we identified one mouse having bacterial translocation in the liver (Table 5). As to detect if livers experienced damage or injury, we measured ALT/AST in the serum of mice treated with L. paracasei ATCC 334–treated, L. reuteri Byun-re-01 and control. We figure out that the AST/ALT levels in all the groups were within the normal ranges (AST 54–298 U/L, ALT 17–77 U/L). Serum AST levels were detected at the levels of 110, 105, and 102 (U/L) in negative control, L. paracasei ATCC 334–treated, and L. reuteri Byun-re-01–treated mice respectively; while serum ALT levels for the respective treatments were 38, 44, and 52 (U/L).
Bacteria
|
Blood | Kidney | Liver | |
---|---|---|---|---|
MRS agar | Negative control | 0/3 | 0/3 | 0/3 |
L. paracasei ATCC 334 | 0/3 | 0/3 | 1/3 | |
L. reuteri Byun-re-01 | 0/3 | 0/3 | 0/3 | |
BHI agar | Negative control | 0/3 | 0/3 | 0/3 |
L. paracasei ATCC 334 | 0/3 | 0/3 | 0/3 | |
L. reuteri Byun-re-01 | 0/3 | 0/3 | 0/3 |
Note: Animals with tissues from which surviving bacterial cells were recovered were defined as bacterial translocation–positive animals. The numbers in this table are (positive animals/all test animals).
Table 5: Incidence of bacterial translocation in mice fed Limosilactobacillus and Lacticaseibacillus strains.
Immune-boosting activity by L. reuteri strain byun-re-01
Lactic acid bacteria are generally known to have health-promoting effects in animal models and clinical trials [27]. Mice treated with L. reuteri Byun-re-01 magnify their mRNA expressions of IFN-β and IFN-γ to 19.8- and 8.8-fold higher, respectively, relative to that of their negative control counterpart. These expressions were also observed to be increasing to 7- and 9.8-fold when relatively compared to L. paracasei ATCC 334 and L. reuteri KACC 11452, respectively (Figure 8). These results are consistent with the widely known about lactic acid bacteria capable of promoting overexpressions of innate immune system-associated cytokines.
Figure 8: Immune boosting activity of L. reuteri Byun-re-01 in gut tissues. Cytokine induction by Limosilactobacillus and Lacticaseibacillus strains treatment in mice intestine was investigated by measuring the IFN expression. The mRNA expressions of (A) IFN-β and (B) IFN-γ were analyzed using qRT-PCR and relative expression of these genes were quantified relative to the GAPDH mRNA expression using the ΔΔCT method. Data are presented as the means ± SEM for n=3. *p<0.05, **p<0.01.
Antiviral effect of L. reuteri strain byun-re-01 against murine norovirus cr6
To evaluate if L. reuteri Byun-re-01 carried protection effect for the mice against MNV infection, three wildtype Limosilactobacillus and Lacticaseibacillus strains, including L. reuteri Byun-re-01, were orally administered to the mice daily for two weeks prior to viral infection. Due to the chronic nature of viral infection in this study, antiviral efficacy was assessed in stool samples at days 5-, 7-, 9-, and 14 post-infections. Compared to the infected mice without probiotic treatment, the L. paracasei-treated infected mice showed an approximately 2.1-fold reduction in viral capsid mRNA expression over time (Figure 9). We, next, assessed the antiviral effect in human- and mice-derived L. reuteri as we presumed that lactic acid bacteria originated from the same organism as the host would have a better impact. Our results demonstrated that the mice treated with human-derived L. reuteri KACC 11452 had a 2.3-fold reduction in viral mRNA compared to that of untreated infected mice-counterpart. As expected, mice-derived L. reuteri Byun-re- 01-treated mice had a 6.6-fold reduction at all sampling periods (Figure 9). These suggested two things. First, L. reuteri Byun-re-01 carried better protection activity against MNV, than did L. paracasei and L. reuteri KACC 11452. Second, the protection was heightened when the bacteria were isolated from the same species as where they were going to be applied.
Figure 9: Comparison of antiviral effect against murine norovirus CR6 among mice treated with Limosilactobacillus and Lacticaseibacillus strains. Relative expression of MNV capsid protein in stool samples of MNV-infected mice without pretreatment and pretreated with L. paracasei ATCC 334, L. reuteri KACC 11452, and L. reuteri Byun-re-01. GAPDH was used as an internal control, and the relative mRNA level of capsid protein was calculated using the ΔΔCT method. Data are presented as the means ± SEM for n=3. **p<0.01, ***p<0.001. Note: Negative control,
MNV infection,
L. paracasei ATCC 334,
L. reuteri KACC 11452,
L. reuteri Byun-re-01
Identification of probiotic markers based on transcriptome screening
In general, information regarding the number of total RNA reads for L. reuteri Byun-re-01 was obtained using next-generation sequencing (Table 6). After removing the adapter sequence using Trimmomatic 0.32 software, we obtained mapped RNA reads using BBmap and applied them for further analysis. Probioticrelated markers of L. reuteri Byun-re-01 (cultured at pH 4.8) were identified using transcriptome analysis. The probiotic-related genes were retrieved from published reports [28-33]. In general, probiotics and hosts interact symbiotically. The health-promoting effect of probiotics, which is defined as a probiotic factor, and an adaptation factor of probiotics inside the hosts, can be expressed as virulence factors [29]. The genome of L. reuteri Byun-re-01 showed virulencerelated factors related to adhesion through data mining, namely a sortase, dltD, dltA (D-adenylation of LTA), hemolysin III, and fibronectin-binding protein (Figure 10). Specifically, we identified exopolysaccharides, important probiotic effector molecules involved in biofilm formation that facilitate the colonization of lactic acid bacteria in the intestines. L. reuteri Byun-re-01 also harbored general stress adaptation proteins, chaperone GroES, GroEL, DnaK, DnaJ, and F0F1 ATP synthase subunits. The level of expression of each gene was gauged as fragments per kilobase of transcript per million mapped reads. Our results demonstrated that the expression levels of most genes were high as illustrated in Figure 10. These suggested that L. reuteri Byun-re-01, derived from the original murine host, could more efficiently colonize in the intestines and persisted for a longer period in mice than that of bacteria originated from foreign organisms. In addition this provided beneficial effects to the host.
Figure 10: Genome-wide screening for probiotic-related genes. Transcriptome analysis was performed to identify probiotic-related genes. The level of expression of each gene is expressed as fragments per kilobase of transcript per million mapped reads. Data are presented as the means ± SEM for n=2.
In the early 20th century, probiotic bacteria were, for the first time, identified by Elie Metchnikoff who discovered particular strains of human gut-residing bacteria that were beneficial to preserve the homeostatis of the gut. Later these bacteria were referred to as probiotics [34]. Soon after, probiotics became a special field in microbiology and attentions toward this intensified following discoveries on new strains of prior-classified bacteria or new bacteria at all which was deemed to be promising to be used in a wide spectrum of commercial commodities within which poultry flock, that undeniably reaches out the livelihood of human being urge a comprehensive improvement in regard with assuring strategy for high-quality and high yield of poultry-related products. On this account, our present study sought to discover novel probiotic bacteria isolated from small intestines of mice that were potential and safe to be harnessed as food preservatives to support the need of high yield-poultry flock for commercial purposes. The probiotic candidates were expected to carry anti-viral activity to enhance the immune response following consumption. When these two features are seen in a candidate (bacterial isolate), that would make them a complete package of a food preservative. That being the case that studies on probiotic bacteria has been bulking up these past few decades [35,36]. Our laboratory has recently accessioned a novel finding of a probiotic strain which was named after L. reuteri- Byun-re-01. The bacteria were pre-engineered to express 3D8 scFv. They exerted antiviral-activity upon challenge with MNV, in an in vivo setting. This looked promising for that particular purpose but as preservative candidate they were not able to show a high survival rate which hindered them to be further used as preservative agents [16]. We then attempted to select potential probiotic bacteria hence we screened more than 200 colonies from the ICR mice’s intestines. Using 16S rDNA, most isolates were identified as L. reuteri strains with 99.47% similarity with those seen in L. reuteri JCM 1112. In the other hand, their gyrB DNA showed 99.64% similarity to L. reuteri strain I49. These two profiles indicated that even though they were phylogenetically related but they were certainly a new strain that differ from the two aforementioned stains (JCM 1112 and I49) (Figure 4). As a result, this new strain might carry different biological characteristics and activities. We, therefore, have registered it on the NCBI genome database with an accession number CP029613 as L. reuteri Byun-re-01 [37].
L. reuteri Byun-re-01, compared to L. paracasei ATCC 334, exerted much better survival in the gastrointestinal tract which is mainly characterized by its extremely low pH, thus abundant colonization was properly facilitated hence the strain was at a proper size to elicit the favorable effects. In another aspect, as both L. reuteri Byun-re-01 and L. paracasei ATCC 334 did not translocate to the livers, they did not induce deteriorating effects especially in livers as the detoxifying organ in the body. This is substantial as bacterial products might affect extra intestinal sites especially Kupffer cells, which are resident macrophages, in livers. These cells would respond by producing toxic forms of oxygens such as superoxide radicals, peroxide anion, single oxygen and hydroxyl radical, after D-galactoamine-induced endotoxin activation. As such, if bacteria migrated and compromised the portal circulation, Kupffer cells are accountable for this clearance. Disturbance of this activity might cause systemic effects of gut barrier failure or endotoxin might reach the systemic circulation which is holistically harmful [38]. Undamaged status of livers post-oral administration of both of L. reuteri Byun-re-01 and L. paracasei ATCC 334 were evident as seen in the level of serum AST/ALT which were all at normal range as did the control group.
We, next, questioned if the bacteria are safe for consumption because literally in every aspect one thing needs to get approval prior to utilization and in this specific case is their safety needs to have validation [39]. To address this, we measured body weights and food intake post-oral administration of L. reuteri Byun-re-01 and observed insignificant changes in body weight and daily food intake in L. reuteri Byun-re-01 –treated compared to that of control, suggesting that the bacteria did not cause appetite loss or maintain appetite in the same level as that of imperturbed/untreated control counterpart. We, unfortunately, did not go any further to draw probable causative connection. However, the disfavored events of type 2 diabetes mellitus (T2DM) might serve as a great example. This is principally a clinical manifestation of altered gut microbiota which is beneficially modified by probiotic treatment which is principally is aimed at maintaining glucose homeostasis which involves insulinotropic and satiety effects mediated by peptide tyrosine tyrosine (PYY) or glucagon-like peptide 1 (GLP1) which further weaken pro-inflammatory cytokines and enhance insulin sensitivity through upregulation of AMPK signalling. It is also acknowledged that interventions with probiotics displayed mixed findings thus far, implying more works for elaboration. Notwithstanding, as the dynamics of body weights as well as daily food intakes in L. reuteri Byun-re-01 –treated group are so close to that seen in control, we presumed that L. reuteri Byun-re-01 was safe for consumption until other future studies bring more solid outcome (Figure 7 and Table 3).
We, next, evaluated the advantage of L. reuteri Byun-re-01-treatment in protecting mice from MNV infection. We found that L. reuteri Byun-re-01 was capable of magnifying the expression of IFN- β and IFN-γ at mRNA level. Although this increase was also detected in L. paracasei-treated groups (strain ATCC 334 and KACC 11452) but L. reuteri Byun-re-01-treated group demonstrated double magnification than that of the L. paracasei groups. This loaded evidence that probiotic bacteria modulated local immune response by producing anti-inflammatory cytokines and inducing regulatory T cells (Tregs) in such complex pathways to assure local intestinal defense [34,40]. We, in this particular study, did not immune-phenotype the specific cells that were accountable for the cytokine productions since we stressed our work at discovery of novel probiotic bacteria to enrich our perspectives on their diversity which further elicited potential for commercial utilization. However, many reports have associated the anti-inflammatory cytokines with dendritic cells and T cells as the producers [40-42]. While Kawashima et al. depicted that DCs produced IFN-β after being challenged with Lactic Acid Bacteria (LAB) double-stranded RNA (dsRNA) which subsequently induced production of IFN-γ by T cells, Gutierrez-Merino et al. recently elucidated that the production of, specifically, IFN-I as a response to LAB necessitated intracellular sensors stimulators of IFN genes (STING) and Mitochondrial Antiviral Signaling (MAVS) to a lesser extent [41,42]. This IFN production was carried on by macrophages population [42]. All these are intriguing to investigate to generate loads of evidences to understand both how probiotic LAB activate their protective properties to defend physiological state of the host, in this specific case is the mice, and how this complex orchestration is hampered.
We next addressed subsequent query on how our L. reuteri Byunre- 01 elicited local protection in the intestine of the host against MNV, which in this study was represented by strain CR6. CR6 was reported to be nonlethal strain that acquired stronger virulence by converting a nucleotide which resulted in amino acid substitution F514I in the viral capsid. This substitution led to beyond 10,000- fold higher replication in systemic organs [43]. To do so, we administered the bacteria to the mice via oral route daily for a couple of weeks. As comparison, we made two counterpart groups that received L. paracasei ATCC 334 and L. reuteri KACC 11452, separately. Stools were sampled at day 5-,7-,9- and 14- after the mice were infected with MNV CR6. Our result indicated that all groups that pre-treated with those three bacteria had suppressed frequencies of MNV viral capsid expression compared to that shown in MNV group which literally had no prior oral administration of bacteria. L. reuteri Byun-re-01 outperformed the other two groups with the reduction reached 6.6 folds lower at all sampling points (Figure 9). An interesting outlook from this results is also about L. reuteri Byun-re-01 had a stronger capability of hindering magnification of the viral capsid than their phylogenetically close counterpart L. reuteri KACC 11452, which was derived from human. Thereby we came into a thought that antiviral efficacy was not only determined by the biological properties of the respective bacteria but also by the origin of the bacteria. As seen in our data that L. reuteri Byunre- 01 had significantly obstructed the multiplication of the viral capsid of MNV CR6 compared to that seen in L. reuteri KACC 11452, a distinguished aspect between the two was literally their origins. L. reuteri Byun-re-01 was mice-derived and applied back to the mice host. This hinted that the bacteria had been educated by the microenvironment or undergone commensalism with other gut-niche microbiome in such a way that they are ready to encounter viral attacks that might skew the overall homeostasis of the digestive system.
While we discerned inhibitory activity against MNV via dynamics of the frequencies of viral capsid mRNA, Lange-Starke et al. previously in 2014 evaluated it from different perspective [44]. The team reported that a mixture of complex metabolite that present in the Cell-Free Supernatants (CFS) of L. curvatus was attributed to the inhibitory activity against MNV, which was further indicated to be a bacteriocin for its proteinaceous nature [44]. These two different approaches seem to be complementary one another and potentially generate new knowledge when are applied together.
Next step in our study was to identify the probiotic markers on a transcriptomic platform. This enabled us to detect some valuable profiles that were virulence-related factors be that, in descending order, dltA, dltD, sortase, hemolysin III, EBP and FbpA (fibronectinbinding- protein A). Specifically, we identified exopolysaccharides, important probiotic effector molecules involved in biofilm formation that facilitates the colonization of lactic acid bacteria in the intestines. L. reuteri Byun-re-01 also harbored general stress adaptation proteins, chaperone GroES, GroEL, DnaK, DnaJ, and F0F1 ATP synthase subunits. The level of expression of each gene was gauged as fragments per kilobase of transcript per million mapped reads. Our results demonstrated that the expression levels of most genes were high as illustrated in Figure 10. These suggested that L. reuteri Byun-re-01, derived from the original murine host, could more efficiently colonize in the intestines and persisted for a longer period in mice than that of bacteria originated from foreign organisms. In addition, this provided beneficial effects to the host.
Complete genome sequencing and transcriptome analysis of the newly isolated L. reuteri Byun-re-01 depicted the expression of several virulence and stress-related genes (Figure 10). The virulence factors included dltD (resistant to low pH conditions), dltA (ability to colonize the GIT), sortase, and hemolysin III, which are required for invasion and adherence to gut tissues [29]. Stress-related genes, including DnaK, DnaJ, GroEL, and GrpE, are involved in longterm acid stress resistance [45-47]. These four genes are heat-shock proteins in probiotics. The universal stress proteins required to overcome physiologic pressure and maintain the host–microbe interaction were highly expressed in L. reuteri Byun-re-01 [29]. The gene encoding exopolysaccharide biosynthesis protein, which is a probiotic effector molecule important for forming biofilm in the gut, was also present [29]. These in silico results support our experimental results and could be the basis for confirming that L. reuteri Byun-re-01 is safe for the host in future studies [48-50].
Overall, our study introduced novel probiotics isolated from mice, L. reuteri Byun-re-0, which was safe, confers an immunomodulatory effect, and thus was advantageous to control MNV infection in mice. This study also proposed a new framework to evaluate the safety of probiotics by combining in vivo and in silico experimental techniques. The combination would provide rapid and efficient assessment from in silico analysis and in-depth analysis through in vivo experiments.
The complete genome of L. reuteri Byun-re-01 has been deposited at GenBank under accession number CP029613. The transcriptome data generated from Illumina sequencing were deposited in GenBank under accession number SRR8988597.s
All animal procedures performed in this study were reviewed, approved, and supervised by the Institutional Animal Care and Use Committee of Sungkyunkwan University (SKKUIACUC2018-10-07-3).
DK, M-jC, E-JK, SL, and SJB designed the experiments and concepts. DK, M-jC, E-JK, and YL performed the experiments, analyses, and data interpretation. The manuscript was drafted by DK, IN, HGJS, and E-JK, HGJS. The study was supervised by SL. All authors discussed the results and commented on the manuscript.
This work was supported by a grant from the Next-Generation BioGreen 21 Program (Project No. PJ01328302), Rural Development Administration, Republic of Korea.
The authors declare no competing interests.
[Crossref]
[Crossref]
[Crossref]
Citation: Kim D, Nurlaila I, Sianipar HGJ, Cho M, Lee Y, Cho S, et al. (2022) A Novel Limosilactobacillus reuteri Strain Byun-re-01 Exhibits Promising Probiotic Properties for Further Use as Preservatives: An In Vivo and In Silico Study. J Infect Dis Preve Med. 10:271.
Received: 04-May-2022, Manuscript No. JADPR-22-17330; Editor assigned: 09-May-2022, Pre QC No. JADPR-22-17330 (PQ); Reviewed: 23-May-2022, QC No. JADPR-22-17330; Revised: 27-May-2022, Manuscript No. JADPR-22-17330 (R); Published: 03-Jun-2022 , DOI: 10.35841/2329-8731.22.10.271
Copyright: © 2022 Kim D, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.